Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4777971
End position: 4777994
Length: 24

DNA sequence
>NC_014814, from 4777971 to 4777994 (24 bp); Mycobacterium sp. Spyr1 CATCGGCATCGGCATCGGCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4777133-4778353	Sequence	Mspyr1_45990 - PE-PPE domain-containing protein (Protein is coded in complementary strand; from 4778353 to 4777133)