Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4771435
End position: 4771458
Length: 24

DNA sequence
>NC_014814, from 4771435 to 4771458 (24 bp); Mycobacterium sp. Spyr1 AGGGCGAGGTCGAGGTCGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4770739-4772880	Sequence	Mspyr1_45940 - PAS domain S-box/diguanylate cyclase (GGDEF) domain-containing protein (Protein is coded in complementary strand; from 4772880 to 4770739)