Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4697040
End position: 4697075
Length: 36

DNA sequence
>NC_014814, from 4697040 to 4697075 (36 bp); Mycobacterium sp. Spyr1 CGGTGACGTCCTCAGGGACGTCCTCGGCAACGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4697030-4697587	Sequence	Mspyr1_45370 - hypothetical protein (Protein is coded in complementary strand; from 4697587 to 4697030)