Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4663163
End position: 4663189
Length: 27

DNA sequence
>NC_014814, from 4663163 to 4663189 (27 bp); Mycobacterium sp. Spyr1 CCGGCCTCGCCGGCCTCGCCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4663028-4665085	Sequence	Mspyr1_45100 - collagen triple helix repeat protein (Protein is coded in complementary strand; from 4665085 to 4663028)