Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4523351
End position: 4523395
Length: 45

DNA sequence
>NC_014814, from 4523351 to 4523395 (45 bp); Mycobacterium sp. Spyr1 AGGCGCGGCGGGCGCAGGGGGGACGGGCGCCGGCGCGGCGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4522842-4524251	Sequence	Mspyr1_43620 - hypothetical protein (Protein is coded in complementary strand; from 4524251 to 4522842)