Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4389213
End position: 4389236
Length: 24

DNA sequence
>NC_014814, from 4389213 to 4389236 (24 bp); Mycobacterium sp. Spyr1 CGTCGCCGTCGCCGTCGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4389170-4392169	Sequence	Mspyr1_42350 - transporter (Protein is coded in complementary strand; from 4392169 to 4389170)