Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4382739
End position: 4382768
Length: 30

DNA sequence
>NC_014814, from 4382739 to 4382768 (30 bp); Mycobacterium sp. Spyr1 GGCGGCGGAGGCGGCGGGGGTGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4382649-4383026	Sequence	Mspyr1_42290 - hypothetical protein (Protein is coded in complementary strand; from 4383026 to 4382649)