Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4336106
End position: 4336129
Length: 24

DNA sequence
>NC_014814, from 4336106 to 4336129 (24 bp); Mycobacterium sp. Spyr1 AGTAGCCGTAGCTGTAGCTGTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4335937-4337454	Sequence	Mspyr1_41800 - capsular exopolysaccharide biosynthesis protein (Protein is coded in complementary strand; from 4337454 to 4335937)