Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4066650
End position: 4066694
Length: 45

DNA sequence
>NC_014814, from 4066650 to 4066694 (45 bp); Mycobacterium sp. Spyr1 GTCCGCGGTGTCGGCGTCCTCGATGTCCGCGTCCGCGGAGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4066486-4067757	Sequence	Mspyr1_39180 - PE-PPE domain-containing protein (Protein is coded in complementary strand; from 4067757 to 4066486)