Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3991334
End position: 3991378
Length: 45

DNA sequence
>NC_014814, from 3991334 to 3991378 (45 bp); Mycobacterium sp. Spyr1 GTGGTGGTCGTGGTCGGGGTGGTCGTGGTGGTGGTCGTGGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3991109-3991645	Sequence	Mspyr1_38480 - hypothetical protein (Protein is coded in complementary strand; from 3991645 to 3991109)