Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3866872
End position: 3866898
Length: 27

DNA sequence
>NC_014814, from 3866872 to 3866898 (27 bp); Mycobacterium sp. Spyr1 CGTTTCCGCCGTATCCGCCGTTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3866772-3867419	Sequence	Mspyr1_37300 - hypothetical protein (Protein is coded in complementary strand; from 3867419 to 3866772)