Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3782651
End position: 3782680
Length: 30

DNA sequence
>NC_014814, from 3782651 to 3782680 (30 bp); Mycobacterium sp. Spyr1 GCCGCTGCGCGCCGCGGCCCGCCGCTGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3782446-3783519	Sequence	Mspyr1_36540 - nucleotidyltransferase/DNA polymerase involved in DNA repair