Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3691114
End position: 3691158
Length: 45

DNA sequence
>NC_014814, from 3691114 to 3691158 (45 bp); Mycobacterium sp. Spyr1 GCTTGGCCGGAGCCTTCTTGGCGGGCGCCTTCTTGGCCGGAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3691101-3691754	Sequence	Mspyr1_35680 - nucleoid protein Hbs (Protein is coded in complementary strand; from 3691754 to 3691101)