Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3650711
End position: 3650764
Length: 54

DNA sequence
>NC_014814, from 3650711 to 3650764 (54 bp); Mycobacterium sp. Spyr1 TTCTGGGAGGGGCTCGGGTTCTGCGACGGGCTCGGGTTCTGCGACGGGCTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3649719-3651134	Sequence	Mspyr1_35290 - signal recognition particle-docking protein FtsY (Protein is coded in complementary strand; from 3651134 to 3649719)