Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3513740
End position: 3513763
Length: 24

DNA sequence
>NC_014814, from 3513740 to 3513763 (24 bp); Mycobacterium sp. Spyr1 TCCGGCTCGGGCTCCGGATCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3512855-3514729	Sequence	Mspyr1_33950 - protoporphyrin IX magnesium-chelatase (Protein is coded in complementary strand; from 3514729 to 3512855)