Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3461160
End position: 3461184
Length: 25

DNA sequence
>NC_014814, from 3461160 to 3461184 (25 bp); Mycobacterium sp. Spyr1 CGGCGGGGCGCGGCAGGGCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3458646-3461315	Sequence	Mspyr1_33390 - DNA segregation ATPase FtsK (Protein is coded in complementary strand; from 3461315 to 3458646)