Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3438590
End position: 3438616
Length: 27

DNA sequence
>NC_014814, from 3438590 to 3438616 (27 bp); Mycobacterium sp. Spyr1 CCGGAGGCGGCGGAGGCGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3438494-3439333	Sequence	Mspyr1_33140 - amino acid ABC transporter substrate-binding protein