Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3431839
End position: 3431862
Length: 24

DNA sequence
>NC_014814, from 3431839 to 3431862 (24 bp); Mycobacterium sp. Spyr1 CGGCGGCGGCGTCGACGGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3431349-3432299	Sequence	Mspyr1_33070 - tRNA isopentenyltransferase MiaA (Protein is coded in complementary strand; from 3432299 to 3431349)