Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3318440
End position: 3318475
Length: 36

DNA sequence
>NC_014814, from 3318440 to 3318475 (36 bp); Mycobacterium sp. Spyr1 CACCGCCTGCGCCACCACCGGCGCCTGCGCCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3317287-3320838	Sequence	Mspyr1_31860 - hypothetical protein (Protein is coded in complementary strand; from 3320838 to 3317287)