Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3277636
End position: 3277671
Length: 36

DNA sequence
>NC_014814, from 3277636 to 3277671 (36 bp); Mycobacterium sp. Spyr1 CATCTGCGCCGACATTTGGGCCGACATCTGGGCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3275228-3278773	Sequence	Mspyr1_31440 - hypothetical protein (Protein is coded in complementary strand; from 3278773 to 3275228)