Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3269809
End position: 3269832
Length: 24

DNA sequence
>NC_014814, from 3269809 to 3269832 (24 bp); Mycobacterium sp. Spyr1 GGCGTACGCGTAGGCGTCGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3269600-3269962	Sequence	Mspyr1_31380 - hypothetical protein (Protein is coded in complementary strand; from 3269962 to 3269600)