Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3239340
End position: 3239366
Length: 27

DNA sequence
>NC_014814, from 3239340 to 3239366 (27 bp); Mycobacterium sp. Spyr1 GCGGAGCTTGCGGAGCTTGCGGAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3238353-3241811	Sequence	Mspyr1_31120 - hypothetical protein (Protein is coded in complementary strand; from 3241811 to 3238353)