Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3191385
End position: 3191408
Length: 24

DNA sequence
>NC_014814, from 3191385 to 3191408 (24 bp); Mycobacterium sp. Spyr1 GGCGACGGCGAACGCGACGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3190690-3191691	Sequence	Mspyr1_30680 - riboflavin biosynthesis protein RibD (Protein is coded in complementary strand; from 3191691 to 3190690)