Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3177459
End position: 3177482
Length: 24

DNA sequence
>NC_014814, from 3177459 to 3177482 (24 bp); Mycobacterium sp. Spyr1 CGTTGTCGATGTCGTTCTCGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3176576-3177559	Sequence	Mspyr1_30560 - P-loop-containing kinase (Protein is coded in complementary strand; from 3177559 to 3176576)