Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3151511
End position: 3151534
Length: 24

DNA sequence
>NC_014814, from 3151511 to 3151534 (24 bp); Mycobacterium sp. Spyr1 CCGTCGTCGTCGCCGTCCCCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3150662-3151600	Sequence	Mspyr1_30310 - glutathione synthase/ribosomal protein S6 modification protein (Protein is coded in complementary strand; from 3151600 to 3150662)