Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3104116
End position: 3104142
Length: 27

DNA sequence
>NC_014814, from 3104116 to 3104142 (27 bp); Mycobacterium sp. Spyr1 CGACGGCCTCGCCGGCCTTGACGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3103722-3106829	Sequence	Mspyr1_29870 - isoleucyl-tRNA synthetase (Protein is coded in complementary strand; from 3106829 to 3103722)