Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3067482
End position: 3067511
Length: 30

DNA sequence
>NC_014814, from 3067482 to 3067511 (30 bp); Mycobacterium sp. Spyr1 CGTCGGCGTTGGCGGCGGCGTCCGAGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3066989-3067609	Sequence	Mspyr1_29530 - imidazole glycerol phosphate synthase subunit hisH (Protein is coded in complementary strand; from 3067609 to 3066989)