Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3056571
End position: 3056594
Length: 24

DNA sequence
>NC_014814, from 3056571 to 3056594 (24 bp); Mycobacterium sp. Spyr1 GCCTCGGTCTCGGCATCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3055575-3057878	Sequence	Mspyr1_29410 - prolipoprotein diacylglyceryl transferase (Protein is coded in complementary strand; from 3057878 to 3055575)