Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3054263
End position: 3054286
Length: 24

DNA sequence
>NC_014814, from 3054263 to 3054286 (24 bp); Mycobacterium sp. Spyr1 CGGCGGCGGCAGCGGCGCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3054084-3055508	Sequence	Mspyr1_29400 - hypothetical protein (Protein is coded in complementary strand; from 3055508 to 3054084)