Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 3032074
End position: 3032097
Length: 24

DNA sequence
>NC_014814, from 3032074 to 3032097 (24 bp); Mycobacterium sp. Spyr1 ACCGCGACGGCGACCACGACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3031480-3033294	Sequence	Mspyr1_29220 - hypothetical protein (Protein is coded in complementary strand; from 3033294 to 3031480)