Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 299017
End position: 299061
Length: 45

DNA sequence
>NC_014814, from 299017 to 299061 (45 bp); Mycobacterium sp. Spyr1 CGGCGGCGGTGTGGGAGACGGCGGTGTGGGAGACGGCGGAGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 298694-302026	Sequence	Mspyr1_02990 - hypothetical protein (Protein is coded in complementary strand; from 302026 to 298694)