Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2893011
End position: 2893046
Length: 36

DNA sequence
>NC_014814, from 2893011 to 2893046 (36 bp); Mycobacterium sp. Spyr1 CGACCTCGGTCGCGACGTCGGTGGTGACCTCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2892761-2893879	Sequence	Mspyr1_27910 - hypothetical protein (Protein is coded in complementary strand; from 2893879 to 2892761)