Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2879988
End position: 2880011
Length: 24

DNA sequence
>NC_014814, from 2879988 to 2880011 (24 bp); Mycobacterium sp. Spyr1 CCCGCAACCGCAGCCGCACCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2878559-2880922	Sequence	Mspyr1_27810 - transcriptional accessory protein (Protein is coded in complementary strand; from 2880922 to 2878559)