Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2822822
End position: 2822857
Length: 36

DNA sequence
>NC_014814, from 2822822 to 2822857 (36 bp); Mycobacterium sp. Spyr1 GATGTCTCCGCTGTCTCCGATGTCTCCGATGTCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2817711-2823206	Sequence	Mspyr1_27260 - polyketide synthase family protein (Protein is coded in complementary strand; from 2823206 to 2817711)