Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2782624
End position: 2782668
Length: 45

DNA sequence
>NC_014814, from 2782624 to 2782668 (45 bp); Mycobacterium sp. Spyr1 GACGCCGAATCCGACGCCGAGGAATCCGACGCCGAGGAATCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2782534-2784894	Sequence	Mspyr1_27090 - PE-PPE domain-containing protein (Protein is coded in complementary strand; from 2784894 to 2782534)