Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2554494
End position: 2554544
Length: 51

DNA sequence
>NC_014814, from 2554494 to 2554544 (51 bp); Mycobacterium sp. Spyr1 GTTGACGACGTCGCCTAGTTGACGACGTCGCCTAGTTGACGACGTCGCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2554263-2554499	Sequence	Mspyr1_24670 - hypothetical protein
ORF... 2554543-2555028	Sequence	Mspyr1_24680 - hypothetical protein (Protein is coded in complementary strand; from 2555028 to 2554543)