Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 249614
End position: 249637
Length: 24

DNA sequence
>NC_014814, from 249614 to 249637 (24 bp); Mycobacterium sp. Spyr1 CGGTGACGTTGACGGTCACGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 247516-255192	Sequence	Mspyr1_02570 - VCBS repeat-containing protein (Protein is coded in complementary strand; from 255192 to 247516)