Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 24941
End position: 24964
Length: 24

DNA sequence
>NC_014814, from 24941 to 24964 (24 bp); Mycobacterium sp. Spyr1 GACGGGGACGGAGGCGGGGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 24875-26431	Sequence	Mspyr1_00240 - serine/threonine protein phosphatase (Protein is coded in complementary strand; from 26431 to 24875)