Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 246607
End position: 246630
Length: 24

DNA sequence
>NC_014814, from 246607 to 246630 (24 bp); Mycobacterium sp. Spyr1 GGTGCCGGTGCCGGTGCCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 245528-246727	Sequence	Mspyr1_02550 - ABC-type Fe3+ transporter periplasmic protein (Protein is coded in complementary strand; from 246727 to 245528)