Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2345154
End position: 2345177
Length: 24

DNA sequence
>NC_014814, from 2345154 to 2345177 (24 bp); Mycobacterium sp. Spyr1 TTCGGGTTCCGGCTCGGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2343661-2345523	Sequence	Mspyr1_22670 - 2-oxoglutarate dehydrogenase E2 component (Protein is coded in complementary strand; from 2345523 to 2343661)