Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2332069
End position: 2332092
Length: 24

DNA sequence
>NC_014814, from 2332069 to 2332092 (24 bp); Mycobacterium sp. Spyr1 TGGCGTTCGCGTTGGCGGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2330997-2334212	Sequence	Mspyr1_22570 - VCBS repeat-containing protein,YVTN family beta-propeller repeat protein (Protein is coded in complementary strand; from 2334212 to 2330997)