Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2290041
End position: 2290064
Length: 24

DNA sequence
>NC_014814, from 2290041 to 2290064 (24 bp); Mycobacterium sp. Spyr1 GCGGCGACGGCGCCGGCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2289639-2290553	Sequence	Mspyr1_22190 - (acyl-carrier-protein) S-malonyltransferase (Protein is coded in complementary strand; from 2290553 to 2289639)