Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2199530
End position: 2199553
Length: 24

DNA sequence
>NC_014814, from 2199530 to 2199553 (24 bp); Mycobacterium sp. Spyr1 CCCCGTCCCCGTCCCCGTCCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2198209-2202588	Sequence	Mspyr1_21340 - amino acid adenylation enzyme/thioester reductase family protein