Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2176225
End position: 2176275
Length: 51

DNA sequence
>NC_014814, from 2176225 to 2176275 (51 bp); Mycobacterium sp. Spyr1 GATCTCCAGCAGAGCCGGTTCTACAGCAGAGCCGGTTCTACAGGAGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2175031-2176227	Sequence	Mspyr1_21240 - coproporphyrinogen III oxidase anaerobic
ORF... 2176263-2177123	Sequence	Mspyr1_21250 - hypothetical protein (Protein is coded in complementary strand; from 2177123 to 2176263)