Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2079100
End position: 2079123
Length: 24

DNA sequence
>NC_014814, from 2079100 to 2079123 (24 bp); Mycobacterium sp. Spyr1 CGGCGTCGACGTCGGCGTCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2078259-2079308	Sequence	Mspyr1_20330 - dehydrogenase (Protein is coded in complementary strand; from 2079308 to 2078259)