Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 2060943
End position: 2060987
Length: 45

DNA sequence
>NC_014814, from 2060943 to 2060987 (45 bp); Mycobacterium sp. Spyr1 GAAGTCGAAGCCGCCGAAGTCGCCGCCACCGAAATCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2060941-2061738	Sequence	Mspyr1_20160 - hypothetical protein (Protein is coded in complementary strand; from 2061738 to 2060941)