Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1921511
End position: 1921534
Length: 24

DNA sequence
>NC_014814, from 1921511 to 1921534 (24 bp); Mycobacterium sp. Spyr1 TCGAACACGAACCCGAACGCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1920989-1922155	Sequence	Mspyr1_18850 - hypothetical protein (Protein is coded in complementary strand; from 1922155 to 1920989)