Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1691162
End position: 1691188
Length: 27

DNA sequence
>NC_014814, from 1691162 to 1691188 (27 bp); Mycobacterium sp. Spyr1 AGCGCGGCGAGCGCGGCCAGCACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1690271-1691509	Sequence	Mspyr1_16660 - H+ antiporter protein (Protein is coded in complementary strand; from 1691509 to 1690271)