Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1675849
End position: 1675884
Length: 36

DNA sequence
>NC_014814, from 1675849 to 1675884 (36 bp); Mycobacterium sp. Spyr1 ACATCACTGAAGACTTCACTGAAGACATCACCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1674226-1676055	Sequence	Mspyr1_16530 - EmrB/QacA subfamily drug resistance transporter