Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 1661191
End position: 1661214
Length: 24

DNA sequence
>NC_014814, from 1661191 to 1661214 (24 bp); Mycobacterium sp. Spyr1 CGACGACGCCGAGGACGACGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1661064-1661756	Sequence	Mspyr1_16420 - hypothetical protein (Protein is coded in complementary strand; from 1661756 to 1661064)